View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19618_high_23 (Length: 358)
Name: NF19618_high_23
Description: NF19618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19618_high_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 349
Target Start/End: Original strand, 28810467 - 28810819
Alignment:
| Q |
1 |
atttaaggtaccttataagcccagcaattatgggtagcctttggatcccgaacctaacaataaacaaagtccaacaaaatgatcaaattattcactatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28810467 |
atttaaggtaccttataagcccagcaattatgggtagcctttggatcccgaacctaacaataaacaaagtccaacaaaatgatcaaattattcactatgt |
28810566 |
T |
|
| Q |
101 |
tacnnnnnnnnnnnnn----gggaagtaacaaacctgagaaaggaaagacatggcagatttgtcatcggagacggaacctgcaatagcgatgaacttgct |
196 |
Q |
| |
|
||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
28810567 |
tacaaaaaaaaaaaaaaaaagggaaataacaaacctgagaaaggaaagacatggcagatttgtcatcggagacggaaccagcaatggcgatgaacttgct |
28810666 |
T |
|
| Q |
197 |
tttcttaatgtctttttcaaaagtgactctttctttgattgttgtgaatgcacctgaattgttactactgctgctggtgctggccatggtggtggacttg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28810667 |
tttcttaatgtctttttcaaaagtgactctttctttgattgttgtgaatgcacctgaattgttactactgctgctggtgctggccatggtggtgaacttg |
28810766 |
T |
|
| Q |
297 |
gctatggcgaagagtgaagcgtagatgcggtggtggtgacgatggtgatgatg |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28810767 |
gctatggcgaagagtgaagcgtagatgcggtggtggtgacgatggtgatgatg |
28810819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University