View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19618_high_37 (Length: 250)
Name: NF19618_high_37
Description: NF19618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19618_high_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 37257663 - 37257445
Alignment:
| Q |
14 |
atatggtgatcattagtagtaaataatctcaaaaccgaaactgctcctgttgattgataatcatataaacaataatttatagaatattaaacaaaggt-- |
111 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37257663 |
atatggtgatcatt--tagtaaataatctcaaaaccgaaactgctcttgttgattgataatcatataaacaataatttatagaatattaaacaaaggtgc |
37257566 |
T |
|
| Q |
112 |
----acatatttataaaagcagtatctcaattaacacatatata--atcaaatttataactcatcttaatggctttggcatctctatataacatactagc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37257565 |
atatacatatttataaaagcagtatctcaattaacacatatatataatcaaatttataactcatcttaatggctttggcatctctatataacatactagc |
37257466 |
T |
|
| Q |
206 |
aatcaatcaaaaaacatgttc |
226 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
37257465 |
aatcaatcacaaaacatgttc |
37257445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University