View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19618_high_41 (Length: 242)
Name: NF19618_high_41
Description: NF19618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19618_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 9 - 116
Target Start/End: Original strand, 15487213 - 15487320
Alignment:
| Q |
9 |
actttgaaatgttcaaatactagacaatatgaaaaagattggaaaagagctatttttgcttgcaaatattagccattttgaaatattcaaatttctcagc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15487213 |
actttgaaatgttcaaatactagacaatatgaaaaagattggaaaagagctatttttggttgcaaatattagccattttgaaataatcaaatttctcagc |
15487312 |
T |
 |
| Q |
109 |
tttcaact |
116 |
Q |
| |
|
|||||||| |
|
|
| T |
15487313 |
tttcaact |
15487320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 159 - 229
Target Start/End: Original strand, 15487362 - 15487432
Alignment:
| Q |
159 |
atcgattacaggttagctactttgtaatgttgaaaaacattgcaatagagctatttttggttgaaaatatt |
229 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15487362 |
atcgattacaggttagctactttgaaatgttgaaaaacatagcaatagagctatttttggttgaaaatatt |
15487432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 54 - 114
Target Start/End: Original strand, 15487408 - 15487468
Alignment:
| Q |
54 |
agagctatttttgcttgcaaatattagccattttgaaatattcaaatttctcagctttcaa |
114 |
Q |
| |
|
||||||||||||| ||| ||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
15487408 |
agagctatttttggttgaaaatatttgccattttgaaatattcaaatttctctgctttcaa |
15487468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University