View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19618_low_25 (Length: 342)
Name: NF19618_low_25
Description: NF19618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19618_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 85 - 331
Target Start/End: Complemental strand, 40075672 - 40075426
Alignment:
| Q |
85 |
ttggatgtgatggaatgaaattcattcatgttcgtcnnnnnnnnagttactgaacctatgcggatgtaaccttattcgagacatgtagtacactaattgt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
40075672 |
ttggatgtgatggaatgaaattcattcatgttcgtctttttattagttactgaacctatgcggatgtaaccttattcgagacgtgtcgtacactaattgt |
40075573 |
T |
|
| Q |
185 |
gagtacttctctcagtagggattcgaactttagttcattgcatgagagatgagagtctagccctctccaccagacccatcctccgtccgtcgttttcatc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
40075572 |
gagtacttctctcagtagggattcgaactttagttcattgcatgagagatgagagtctagccctctccactagacccatcctccgtccgtcgttttcgtc |
40075473 |
T |
|
| Q |
285 |
ctattttaaacatatcaaacaatagaatatttatgattgcatttcat |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40075472 |
ctattttaaacatatcaaacaatagaatatttatgattgcatttcat |
40075426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 54
Target Start/End: Complemental strand, 40075770 - 40075735
Alignment:
| Q |
19 |
attgatttgtttcatgtctttttctgcaaattggaa |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40075770 |
attgatttgtttcatgtctttttctgcaaattggaa |
40075735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University