View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19618_low_30 (Length: 297)
Name: NF19618_low_30
Description: NF19618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19618_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 61 - 275
Target Start/End: Original strand, 6083004 - 6083220
Alignment:
| Q |
61 |
tgaatcgaaaaatttgacaaaagatttatggattttagttatgtttgctaaaatgaagtttagacaaaagtgtaaaccgggatgttttggaaaagttttc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6083004 |
tgaatcgaaaaatttgacaaaagatttatggattttagttatgtttgctaaaatgaagtttagacaaaagcgtaaaccgggatgttttggaaaagttttc |
6083103 |
T |
 |
| Q |
161 |
cataatgtattgaccttggggtaaatatattgaattttaggaaggtgaataaact---ttttattaacattctagaaaactcagtttcacattttctggt |
257 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6083104 |
cataatgtatt-accttggggtaaaaatattgaattttaggaaggtgaataaactcagttttattaacattctagaaaactcagtttcacattttctggt |
6083202 |
T |
 |
| Q |
258 |
ttacaattttagctaccg |
275 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6083203 |
ttacaattttagctaccg |
6083220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 6082769 - 6082807
Alignment:
| Q |
1 |
cacaagatattctcggtaaataaaagttttcctgaattg |
39 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
6082769 |
cacaagatattcttggtaaataaaagtttttctgaattg |
6082807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University