View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19618_low_31 (Length: 295)
Name: NF19618_low_31
Description: NF19618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19618_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 32 - 283
Target Start/End: Complemental strand, 52988699 - 52988448
Alignment:
| Q |
32 |
agccataagcattgttgctcagaaaaagctcagccccagaagtgtgcctcccagtcatgctcctcaaagaatccatcctgcacttcaaatccaagtttaa |
131 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52988699 |
agccataagcgttgttgctcagaaaaagctcagccccagaagtgtgcctcccagtcatgctcctcaaagaatccatcctgcacttcaaatccaagtttaa |
52988600 |
T |
 |
| Q |
132 |
ttggaaatgttaaccctctcaaaaacatggagaatcatgatcattgtcatcaaggaagctgcgacaagagtcgagatggagtccagaagcataatattga |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52988599 |
ttggaaatgttaaccctctcaaaaacatggagaatcatgatcactgtcatcaaggaagctgcgacaagagtcgagatggagtccagaagcataatattga |
52988500 |
T |
 |
| Q |
232 |
aaacaagtgttgttcagattttcatgatttgaatctaaatgcagaagatatt |
283 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52988499 |
aaacaagttttgttcagattttcatgatttgaatctaaatgcagaagatatt |
52988448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University