View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19618_low_34 (Length: 275)
Name: NF19618_low_34
Description: NF19618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19618_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 266
Target Start/End: Original strand, 41226326 - 41226572
Alignment:
| Q |
19 |
tggaagagaaaagaaggtttacccttaccctgtcaatgtggttggggttagagggacggggtcgttgttcaaccagccaaccatcgggaacctcaacctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41226326 |
tggaagagaaaagaaggtttacccttaccctgtcaatgtggttggggttagagggacggggtcgttgttcaaccagccaaccatcgggaacctcaacctt |
41226425 |
T |
|
| Q |
119 |
ggacggtgactggaccacaatctgcaattctttttcccttaaattcatcgcattgcgattcaaattgagatgttccatttcaacatccatgcttctattc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41226426 |
ggacggtgactggaccacaatctgcaattctttttcccttaaattcatcacattgcgattcaaattgagatgttccatttcaacatccatgcttctattc |
41226525 |
T |
|
| Q |
219 |
attcggtgctatcgtttaaggacatgatcagatcatgatgatgatgat |
266 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
41226526 |
attcggtgctctcgtttaaggacatgatcagatca-gatcatgatgat |
41226572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 121 - 168
Target Start/End: Original strand, 41220312 - 41220359
Alignment:
| Q |
121 |
acggtgactggaccacaatctgcaattctttttcccttaaattcatcg |
168 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
41220312 |
acggtgaccggataacaatctgcaattctttttcccttgaattcatcg |
41220359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 43 - 111
Target Start/End: Complemental strand, 1596041 - 1595973
Alignment:
| Q |
43 |
ttaccctgtcaatgtggttggggttagagggacggggtcgttgttcaaccagccaaccatcgggaacct |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1596041 |
ttaccttgtcaatgtggttggggttagagacacggggtcgttgttcaaccaaccaaccatcgggaacct |
1595973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University