View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19618_low_35 (Length: 255)
Name: NF19618_low_35
Description: NF19618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19618_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 243
Target Start/End: Complemental strand, 2138198 - 2137965
Alignment:
| Q |
16 |
ataacaacacttcgcatgttgtt------gttgttgttttggaacatcatgggattttccgacacgttgagttggagttttttagaacggcgttcgtgga |
109 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2138198 |
ataacaacacttcgcatgttgttattgttgttgttgttttggaacatcatgggattttccgacacgttgagttggagttttttagaacggcgttcgtgga |
2138099 |
T |
|
| Q |
110 |
gtttgaagttgggnnnnnnnaagcccattggtggttccatggtggttgttggtagaggacggtgggcttgggcttgggcttgggctgttagacgagatgg |
209 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2138098 |
gtttgaagttgggtttttttaagcccattggtggttccatggtggttgttggtagaggacggtgggcttgggcttgggcttgggctgttagacgagatgg |
2137999 |
T |
|
| Q |
210 |
gagtgtgagtgggagtttttgggctgatgggtct |
243 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
2137998 |
gagtgttagtgggagtttttgggctgatgggtct |
2137965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University