View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19618_low_37 (Length: 251)
Name: NF19618_low_37
Description: NF19618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19618_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 6 - 183
Target Start/End: Complemental strand, 15487191 - 15487015
Alignment:
| Q |
6 |
caaagttaaataaatgagatatacttcaattataaattccttatgaacaaagcatataatttctacgtatttgccagcaaaatattgtgctacgaacttg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15487191 |
caaagttaaataaatgagatatacttcaattataaattccttatgaacaaagcatataatttctacgtatttgccagaaaaatattgtgctacgaacttg |
15487092 |
T |
 |
| Q |
106 |
gtggagtaaatgaagggtaacagtgcaatttaaccaagaggtgttcgtggtaaatgattttctgattttaatgaacaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15487091 |
gtggagtaaatgaagggtaacagtgcaatttaaccaagagttgttcgtggtaaatgattttctga-tttaatgaacaa |
15487015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University