View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19618_low_43 (Length: 241)
Name: NF19618_low_43
Description: NF19618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19618_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 26532482 - 26532706
Alignment:
| Q |
1 |
gtcacgttcgtctaaagggattttaaaaccgcgtaagatggaacgcaccgttttgcaatcttcgtaggttgttctaaccacgcgcagggatgtgaagtag |
100 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26532482 |
gtcacgttcgtctaaatggattttgaaaccgcgtaagatggaacgcaccgttttgcaatcttcgtaggttgttctaaccacgcgcagggatgtgaagtag |
26532581 |
T |
 |
| Q |
101 |
attaccacgcgctgctgtgaagaggggattaatgaaggttgggcgacgcgtgaagcgcgtggatcgttgggggagagtggagaagaggtgtaagtgagtt |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26532582 |
attaccacgcgctgctgagaagaggggattaatgaaggttgggcggcgcgtgaagcgcgtggatcgttgggggagagtggagaagaggtgtaagtgagtt |
26532681 |
T |
 |
| Q |
201 |
tgggttgatttgaccaggctcggag |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26532682 |
tgggttgatttgaccaggctcggag |
26532706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University