View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19618_low_52 (Length: 203)
Name: NF19618_low_52
Description: NF19618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19618_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 185
Target Start/End: Original strand, 53659959 - 53660128
Alignment:
| Q |
17 |
cagagaacaattgcaaagctaaagacatcagctttgtgatcataaggtttatgctcaataacctttcatatgtaagagagatcacaaattagttgtaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53659959 |
cagagaacaattgcaaagctaaagacatcagctttgtgatcatatggtttatgctcaataacctttcatatgtaagagagatcacaaattagttgtaatt |
53660058 |
T |
 |
| Q |
117 |
gttttga-caaagacaagaataaaccacacacaagttggaagatcaaaggaaaaagaggaaagaacaaga |
185 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53660059 |
gttttgaccaaagacaagaataaaccacacacaagtcggaagatcaaaggaaaaagaggaaagaacaaga |
53660128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University