View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1961_low_10 (Length: 358)
Name: NF1961_low_10
Description: NF1961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1961_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 344
Target Start/End: Complemental strand, 7405823 - 7405480
Alignment:
| Q |
1 |
gagatgaaccaaatacggacaaagctttttctccacttaccttatactccttaactttaactctcatagctacaccttcttcatccaccatcacttttct |
100 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7405823 |
gagaagaaccaaacacggacaaagctttttctccacttaccttatactccttaactttaactctcatagctacaccttcatcatccaccatcacttttct |
7405724 |
T |
|
| Q |
101 |
aatcacctccgctatcttttccctacaaacaacaccaccctctgccaccgctgttgtcgctttcaccgccacaccaagctcctctgataacatagttgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7405723 |
aatcacctccgctatcttttccctacaaacaacaccaccctctgccaccgtttttgtcgctttcaccgccacaccaagctcctctgataacatagttgca |
7405624 |
T |
|
| Q |
201 |
ttcatcttctgctctgcataaagcggccatgcaaccattggaacaccgttatgaatactctccaacacagaattccaaccgcaatgtgtcaaaaaaccac |
300 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7405623 |
ttcatcttctgctcagcataaagcggccatgcaaccattggaacaccgttatgaatactctccaacacagaattccaaccacaatgtgtcaaaaaaccac |
7405524 |
T |
|
| Q |
301 |
ccgttgaaggatgtttcaatatttcagcttgaggggcccacatg |
344 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7405523 |
ccgttgaaggatgtttcaatatctcagcttgaggggcccacatg |
7405480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University