View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1961_low_15 (Length: 273)
Name: NF1961_low_15
Description: NF1961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1961_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 263
Target Start/End: Complemental strand, 8897160 - 8896915
Alignment:
| Q |
18 |
gttatgacgctaactacagttttcacaaccaaaaccttgctnnnnnnnctgatttggatcatgcagtgcatgattctcctagtgctggtcagggttttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8897160 |
gttatgacgctaactacagttttcacaaccaaaaccttactgaaaaaactgatttggatcatgcagtgcatgattctcctagtgctggtcagggttttgg |
8897061 |
T |
|
| Q |
118 |
caatgacttttgtcatgcttcaaatcatattaatagttgtggcaatgttggagaggttatttcaaatgcggttactaagaattcaagaacttctagtgat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8897060 |
caatgacttttgtcatgcttcaaatcatattaatagtcgtggcaatgttggagaggctatttcaaatgcggttactaagaattcaagaacttctagtgat |
8896961 |
T |
|
| Q |
218 |
ggtaggcgctatagtcatagtaattatgattatgattgtgatgatg |
263 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8896960 |
ggtaggcgctataatcatagtaattatgattatgattgtgatgatg |
8896915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University