View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19620_low_15 (Length: 232)
Name: NF19620_low_15
Description: NF19620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19620_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 14 - 213
Target Start/End: Complemental strand, 3374011 - 3373812
Alignment:
| Q |
14 |
cagagagatagcctggcatttgagctcctgcggacacatggcttcaaagtgtcaccatgtatgatctttaagcgttattattttttaattaaaagattct |
113 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3374011 |
cagaaagatagtctggcatttgagctcctgcggacacatggcttcaaagtgtcaccatgtatgatctttaagcgttattattttttaattaaaagattct |
3373912 |
T |
 |
| Q |
114 |
gtaaatcccaaaactaaaaatttttggacaagaaaatgtaacgtgtcactaaattttcttcttacatcttaggtaaaataagtttatatacttacttttt |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3373911 |
gtaaatcccaaaactataaatttttggacaagaaaatgtaacgtgtcactaaattttcttcttacatcttaggtaaaataagcttatatacttacttttt |
3373812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 14 - 81
Target Start/End: Complemental strand, 3347601 - 3347534
Alignment:
| Q |
14 |
cagagagatagcctggcatttgagctcctgcggacacatggcttcaaagtgtcaccatgtatgatctt |
81 |
Q |
| |
|
|||| |||||| ||||||||||||||||| |||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
3347601 |
cagaaagatagtctggcatttgagctccttaggacacatggatttaaagtatcaccatgtatgatctt |
3347534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University