View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19620_low_5 (Length: 349)
Name: NF19620_low_5
Description: NF19620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19620_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 27 - 328
Target Start/End: Complemental strand, 25065419 - 25065117
Alignment:
| Q |
27 |
ctctctttccttggatgatag-tctcaaggtcgcaaccctcttgatttgccttctcgatgtagtgaaatgggtagtgaattgtatacgtagttcctccca |
125 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
25065419 |
ctctctttccttggatgatagctttcaaggtcgcaaccttcttggtttgccttctcgatgtagtgaaatgggtcgtgaattgtatacatagttcctccca |
25065320 |
T |
 |
| Q |
126 |
agagtcgatggactcttctctcaagcttttgcataatttcaaggctcccattaggcaccgtgaaaagagcctaaatttgaccgctccttgaacgttatga |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25065319 |
agagtcgatggactcttctctcaagcttttgcataatttcaaggctcccattaggcaccgtgaaaagagcctaaatttgaccgctcctcgaacgttatga |
25065220 |
T |
 |
| Q |
226 |
tacttgaggacgacttcaatgttttcaatgtattcatttgcatatgtggttccattgtacggatccatccggctttcctaaacctactcgattgcatgat |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25065219 |
tacttgaggacgacttcaatgttttcaatgtattcatttgcatatgtggttccattttacggatccatccggctttcctaaacctactcgattgcatgat |
25065120 |
T |
 |
| Q |
326 |
tct |
328 |
Q |
| |
|
||| |
|
|
| T |
25065119 |
tct |
25065117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University