View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19621_low_13 (Length: 296)
Name: NF19621_low_13
Description: NF19621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19621_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 21 - 200
Target Start/End: Original strand, 26185242 - 26185422
Alignment:
| Q |
21 |
tgtatgcttcaatgggaccaatttaaattata-cttaaacggttgtggtagattattatgtttttcataaaatatctcattaattactatgttacgttgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26185242 |
tgtatgcttcaatgggaccaatttaaattataacttaaacggttgtggtagattattatgtttttcataaaatatctcattaattactatgttacgttgt |
26185341 |
T |
 |
| Q |
120 |
tatattactttatagtaaattatttcaacaaacatctgcaagatatgattagaggatactgtcaagaaaaaatttagcctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26185342 |
tatattactttatagtaaattatttcaacaaacatctgcaagatatgattagaggatactgtcaagaaaaaatttagcctt |
26185422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 225 - 281
Target Start/End: Original strand, 26185415 - 26185471
Alignment:
| Q |
225 |
ttagccttgcattttttatctttttatttcatatcatgttctaatttggatacctat |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26185415 |
ttagccttgcattttttatctttttatttcatatcatgttttaatttggatacctat |
26185471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University