View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19621_low_15 (Length: 279)

Name: NF19621_low_15
Description: NF19621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19621_low_15
NF19621_low_15
[»] chr3 (1 HSPs)
chr3 (1-263)||(46813793-46814055)


Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 46814055 - 46813793
Alignment:
1 ttgagaatacgcatgggtatgaagctactgatgagaataagcttaaggtttatggtaaggattttcttgggtgggcgaaaccggaagtcgctgatgagtc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46814055 ttgagaatacgcatgggtatgaagctactgatgagaataagcttaaggtttatggtaaggattttcttgggtgggcgaaaccggaagtcgctgatgagtc 46813956  T
101 tatgtgggaagatgctgatgatagcttctcgaagagtcctggttcggccacgccagtgagagcaagtcaggatttgagggaggaatttgaggaagctgca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
46813955 tatgtgggaagatgctgatgatagcttctcgaagagtcctggttcggccacgccagtgagagcgagtcaggatttgagggaggaatttgaggaagctgca 46813856  T
201 aatggtgggattcagagcttggcgcttggtgctctggataacagtttcttggttggtgaaaat 263  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46813855 aatggtgggattcagagcttggcgcttggtgctctggataacagtttcttggttggtgaaaat 46813793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University