View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19621_low_23 (Length: 206)
Name: NF19621_low_23
Description: NF19621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19621_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 15 - 188
Target Start/End: Complemental strand, 24871462 - 24871293
Alignment:
| Q |
15 |
cagagacaaccattaacaaatgtcacattgaactaggaaatgtccattcagtattattgtagaacaaattggatatataaaaatcttcttgaaaaatctt |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24871462 |
cagacacaaccattaacaaatgtcacattgaactaggaaatgtccattcagtattattgtagaacaaattggata----aaaatcttcttgaaaaatctt |
24871367 |
T |
|
| Q |
115 |
ttttgtttcctagtcctttcatccacacaaaatatggtgagggtcacttttctttcattttcactcacaatcac |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24871366 |
ttttgtttcctagtcctttcatccacacaaaatatggtgagggtcacttctctttcattttcactcacaatcac |
24871293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University