View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19621_low_9 (Length: 328)
Name: NF19621_low_9
Description: NF19621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19621_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 16 - 280
Target Start/End: Complemental strand, 24042469 - 24042205
Alignment:
| Q |
16 |
aatctctcttcttacatcctccacatcctcttgtgttgttaatttcctctttgcaattgacttgcaagcaaattccttattagtcccttttgccatacat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24042469 |
aatctctcttcttacatcctccacatcctcttgtgttgttaatttcctctttgcaattgacttgcaagcaaattccttattagtcccttttgccatacat |
24042370 |
T |
 |
| Q |
116 |
agaaatgttgtcccaaattgcccttgacctaattttctccccaaactgtaaaaatcttttatgttttcagttttccttcccaatacagattctacctgaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24042369 |
agaaatgttgtcccaaattgcccttgacctaattttctccccaaactgtaaaaatcttttatgttttcagttttccttcccaatacagattctacctgaa |
24042270 |
T |
 |
| Q |
216 |
gtccaatacttgataatcttttcacatgtgttggtttcttaggtttatctgcatcaccctcgccc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24042269 |
gtccaatacttgataatcttttcacatgtgttggtttcttaggtttatccgcatcaccctcgccc |
24042205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University