View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19622_high_9 (Length: 348)
Name: NF19622_high_9
Description: NF19622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19622_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 3e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 8 - 158
Target Start/End: Original strand, 8900517 - 8900667
Alignment:
| Q |
8 |
tccaagaaaatgaagaaaaataaacttacctttgtaatgacaattattgagaagtgaagtaattaacctccgagtagcacgatcagattcaacaagaaga |
107 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8900517 |
tccaacaacatgaagaaaaataaacttacctttgtaatggcaattatttagaagtgaagtaattaacctccgagtagcacgatcagattcaacaagaaga |
8900616 |
T |
 |
| Q |
108 |
acagtaacattttttcttggtagaaacatttcccatctaaatacaccgtcc |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8900617 |
acagtaacattttttcttggtagaaacatttcccatctaaatacaccgtcc |
8900667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University