View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19622_low_14 (Length: 300)
Name: NF19622_low_14
Description: NF19622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19622_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 17 - 291
Target Start/End: Original strand, 5296188 - 5296460
Alignment:
| Q |
17 |
atttgagggtaaaatacaacaaaaatattcttatcaaacatttacaaatatgatnnnnnnnnntatgatacaatttatggataagctagtgtacagcatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5296188 |
atttgagggtaaaatacaacaaaaatattcttatcaaacatttacaaatatgataaaaaaa--tatgatacaatttatggataagctagtgtacagcatg |
5296285 |
T |
 |
| Q |
117 |
agatattgaatcttatggcatattttgtgaaagaaaattcacaaatgttttacacatcattcaaacagatgggtgaatgtgatctataccattttcatct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5296286 |
agatattgaatcttatggcatattttgtgaaagaaaattcacaaatgttttacacatcatacaaacagatgggtgaatgtgatctataccattttcatct |
5296385 |
T |
 |
| Q |
217 |
gctaattatcagtcaagttatcctcacaatagggatgtgacagattttatgccaatgttttccttcctccctttg |
291 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
5296386 |
gctaattatcagtcaagctatcctcacaatagggatgtgacaaattttatgccaatgttttccttcctccttttg |
5296460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University