View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19623_low_13 (Length: 251)
Name: NF19623_low_13
Description: NF19623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19623_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 48011537 - 48011321
Alignment:
| Q |
16 |
attatgtaggaaatatggtagattattcacaaggtttttcagcaactaat---tattttgaggtaatttgcttgatatttgtactactctatagtttaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48011537 |
attatgtaggaaatatggtagattattcacaaggtttttcagcaactaataattattttgaggtaatttgcttgatatttgtactactctatagtttaca |
48011438 |
T |
 |
| Q |
113 |
ctttgattttgtatttgctaaaattgttaatctgtgttatttgtagggaaaatcctcataccaagaagaaaaattcggttttttacaaccacctctctca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48011437 |
ctttgattttgtatttgctaaaattgtt----tgtgttatttgtagggaaaatcatcataccaagaagaaaaattcggttttttacaaccacctctctca |
48011342 |
T |
 |
| Q |
213 |
aaaaatgatcttcaaggcaac |
233 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
48011341 |
aaaaatgatcttcaaggcaac |
48011321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University