View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19623_low_15 (Length: 235)
Name: NF19623_low_15
Description: NF19623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19623_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 213
Target Start/End: Complemental strand, 36044921 - 36044726
Alignment:
| Q |
18 |
tacttcacgaggattcctcttcatttcgaagttcttgtggcatttcgatctacaaaaccgaaatatctgcacaaaaactttgatgtcaagaagttaaaca |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36044921 |
tactttacgaggattcctcttcatttcgaagttcttgtggcatttcgatctacaaaaccgaaatatctgcacaaaaactttgatgtcaagaagttaaaca |
36044822 |
T |
 |
| Q |
118 |
atagtttacatttggattggcagtgagtttgcagaatcagtgtgctagcggcagcgtaattttgacaaaatacttgaaacttcaaaacaaccgcgt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
36044821 |
atagtttacatttggattggcagtgagtttgcagaatcagtgtgctagcggcagcataattttgacaaaatattcgaaacttcaaaacaaccgcgt |
36044726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 85
Target Start/End: Original strand, 20108260 - 20108320
Alignment:
| Q |
25 |
cgaggattcctcttcatttcgaagttcttgtggcatttcgatctacaaaaccgaaatatct |
85 |
Q |
| |
|
||||||||||||||||||| ||| || |||||||| || ||||||||||| ||||| |||| |
|
|
| T |
20108260 |
cgaggattcctcttcattttgaaatttttgtggcacttggatctacaaaatcgaaaaatct |
20108320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University