View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19624_high_2 (Length: 288)
Name: NF19624_high_2
Description: NF19624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19624_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 13 - 174
Target Start/End: Complemental strand, 32459496 - 32459335
Alignment:
| Q |
13 |
aatatttgattagctagtgggggtaaagtgggtaatgaattataactatttatagaaattccttaattagtgttgcttttctctttcggttgctttgtcc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32459496 |
aatatttgattagctagtgggggtaaagtgggtaatgaattataactatttatagaaattccttaattagtgttgcttttctctttcggttgctttgtcc |
32459397 |
T |
 |
| Q |
113 |
attatccattctatatattttacaaaaacaaactaaactaatttcattaataaaaattgcat |
174 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
32459396 |
attatatattctatatattttacaaaaacaaactaaactaaattcattaataaaagttgcat |
32459335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 231 - 266
Target Start/End: Complemental strand, 32459325 - 32459290
Alignment:
| Q |
231 |
ttgcctaatgaattttatcacaaggtttgaattccc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32459325 |
ttgcctaatgaattttatcacaaggtttgaattccc |
32459290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University