View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19624_high_3 (Length: 280)
Name: NF19624_high_3
Description: NF19624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19624_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 8458328 - 8458611
Alignment:
| Q |
1 |
tcaggttcttagttcactatttctcaaaataacacactgaaatacatgctcaagtgggggtgtgtatggtcagcgcaaatttatatgcatttttcttatt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8458328 |
tcaggtttttagttcactatttctcaaaataacacactgaaatacatgctcaagtgggggtgtgtatggtcagcgcaactttatatgcatttttcttatt |
8458427 |
T |
 |
| Q |
101 |
tcgtatggaaactacaagcctggttatggtataattgatttatgtaaaattaattttgcatttggaaataaattttgctatgtgaattgaaatattaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8458428 |
tcgtatggaaactacaagcctggttatggtataattgatttatgtaaaattaattttgcatttggaaataaattttgctatgtgaattgaaatattaagg |
8458527 |
T |
 |
| Q |
201 |
aatagaagggatatttaggtttaaaggttactgattaataagg------ttacccactgcgaatatgacatattcttcgacatc |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||| ||||| |
|
|
| T |
8458528 |
aatagaagggatatttaggtttaaaggttactgattaataaggtgccttttaaccactgcgaatatgacattttcttctacatc |
8458611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University