View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19624_low_10 (Length: 244)
Name: NF19624_low_10
Description: NF19624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19624_low_10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 244
Target Start/End: Complemental strand, 11404749 - 11404529
Alignment:
| Q |
20 |
ggcttaaccttgggttttattactcagtttttgttcttgttcatccatttttgttgtatctttgatttcgtaatatgaatgttagaacttcttgaattct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11404749 |
ggcttaaccttgggttttattactcagtttttgttcttgttcatccatttttgttatatctttgatttcgtaatatgaatgttagaacttcttgaattct |
11404650 |
T |
 |
| Q |
120 |
atcattacatttcttgtgttagttaggattatcagtttgtagtgattaaatattttcttttaccttcttaaaagaatgatgctaaatgaaaaagagatat |
219 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11404649 |
atcattacattttttgtgttagttaggattatcagtttgt----attaaatattttattttaccttcttaaaagaatgatgctaaatgaaaaagagatat |
11404554 |
T |
 |
| Q |
220 |
ttggagttgtttgattacagttttt |
244 |
Q |
| |
|
|||| | ||||||||||||| |||| |
|
|
| T |
11404553 |
ttggggctgtttgattacagctttt |
11404529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University