View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19624_low_12 (Length: 227)
Name: NF19624_low_12
Description: NF19624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19624_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 44; Significance: 3e-16; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 7 - 74
Target Start/End: Original strand, 6405647 - 6405714
Alignment:
| Q |
7 |
accagaacttcgatgatagaaacataatgactttgggtcctattcatatacacctaaactaaatgtgt |
74 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||| |||||||| |||| ||||||||||| ||||| |
|
|
| T |
6405647 |
accataacttcgatgatggaaacataatgactttggatcctattcgtatatacctaaactaattgtgt |
6405714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 227
Target Start/End: Original strand, 14796235 - 14796292
Alignment:
| Q |
170 |
attaacggtggtgtcggcgtgtcagtgtccgtgtcatgtgtaaccctatacccttaaa |
227 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
14796235 |
attaacggttgtgtcggcatgtcagtgtccgtgtcatgtgtaaccctaaacctttaaa |
14796292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 9 - 74
Target Start/End: Complemental strand, 6590323 - 6590258
Alignment:
| Q |
9 |
cagaacttcgatgatagaaacataatgactttgggtcctattcatatacacctaaactaaatgtgt |
74 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || || |||||||||| ||||| | ||||||||| |
|
|
| T |
6590323 |
cagaacttcgatgatggaaacataatgacttaggatcttattcatatatacctagattaaatgtgt |
6590258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 208
Target Start/End: Original strand, 8587076 - 8587104
Alignment:
| Q |
180 |
gtgtcggcgtgtcagtgtccgtgtcatgt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8587076 |
gtgtcggcgtgtcagtgtccgtgtcatgt |
8587104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 208
Target Start/End: Original strand, 30404905 - 30404933
Alignment:
| Q |
180 |
gtgtcggcgtgtcagtgtccgtgtcatgt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30404905 |
gtgtcggcgtgtcagtgtccgtgtcatgt |
30404933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University