View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19624_low_13 (Length: 208)
Name: NF19624_low_13
Description: NF19624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19624_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 33 - 184
Target Start/End: Original strand, 47713663 - 47713814
Alignment:
| Q |
33 |
tgtcggggacaacatggaagaagaagtcaagacatgggttgcaagtagtgagatatgttggtgacatgttttctgttaaagtcattggtgggttttggtt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47713663 |
tgtcggggacaacatggaagaagaagtcaagacatgggttgccagtagtgagatatgttggtgacatgttttctgttagagtcattggtgggttttggtt |
47713762 |
T |
 |
| Q |
133 |
tgtatgaagggtgttgaaatttgttaccatttgatcgatggaagttttgtta |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47713763 |
tgtatgaagggtgttgaaatttgttaccatttgatcgatggaagttttgtta |
47713814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 35 - 102
Target Start/End: Original strand, 15835851 - 15835918
Alignment:
| Q |
35 |
tcggggacaacatggaagaagaagtcaagacatgggttgcaagtagtgagatatgttggtgacatgtt |
102 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| | || | |||| |||| ||||||||||| |
|
|
| T |
15835851 |
tcggggacaacatggaagaagaaatcaaggcatgggttaccggtggagagaaatgtcggtgacatgtt |
15835918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University