View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19625_high_4 (Length: 329)
Name: NF19625_high_4
Description: NF19625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19625_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 19 - 319
Target Start/End: Complemental strand, 43291405 - 43291106
Alignment:
| Q |
19 |
agatcctatttatatgttattcataagaaataaacaaatataattggaagcatcaaaatgatccnnnnnnnnnnnnttgggatgatataggatatgagat |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43291405 |
agatcatatttatatgttattcataagaaataaacaaatataattggaagcatcaaaatgatccaaaaaaaataa-ttgggatgatataggatatgagat |
43291307 |
T |
 |
| Q |
119 |
attcctgaatgtgtccagggggaaagggtatgttctgttgaggcattattagctagctagagtctccggttgaatgctcatgtcatgtcaacatggaaaa |
218 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43291306 |
attcctgaatgtgtccagggggaaaaggtatgttctgttgaggcattattagctagctagagtctcatgttgaatgctcatgtcatgtcaacatggaaaa |
43291207 |
T |
 |
| Q |
219 |
taaatataattggcgtccgtccaagaagcctcaattcattcatcccacttaagccagcctgtgttgggagtagtaaccatatatatctggttttgtctct |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43291206 |
taaatataattggcgtccgtccaagaagcctcaattcattcatcccacttaagccagcctgtgttgggagtagtaaccatatatatctggttttgtctct |
43291107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University