View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19625_low_2 (Length: 470)
Name: NF19625_low_2
Description: NF19625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19625_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 421 - 458
Target Start/End: Complemental strand, 35019234 - 35019197
Alignment:
| Q |
421 |
attaattagcacctattcatcattgtattagttgccta |
458 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35019234 |
attaattagcacctattcatcattgtattagttgccta |
35019197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 160 - 192
Target Start/End: Original strand, 8939970 - 8940002
Alignment:
| Q |
160 |
tctactttattgaaattttaaaataatctatca |
192 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
8939970 |
tctaatttattgaaattttaaaataatctatca |
8940002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University