View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19625_low_6 (Length: 283)
Name: NF19625_low_6
Description: NF19625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19625_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 23016535 - 23016801
Alignment:
| Q |
1 |
atcacccaatagatctttgtaccttcacccaagttcaagcacgtgtcaaatataacccttagacatgtatttgctggtaagctaataccttatgcnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23016535 |
atcacccaatagatctttgtaccttcacccaagttcaagcacatgtcaaatataacccttagacatgtatttgctggtaagctaataccttatgcaaaaa |
23016634 |
T |
|
| Q |
101 |
nnnntacactacagtgttttgttcgtacattttgtatattggcgactcataatgcatgtgtcaagtcatgtttggccttcaaaaacacaatttttcgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23016635 |
aaaatacactacagtgttttgttcgtacattttgtatattggcgactcataatgcatgtgtcaagtcatgtttggccttcaaaaacacaatttttcgaaa |
23016734 |
T |
|
| Q |
201 |
atatgataagttgaatttctatacctgggcatgctgatgaaatcattggcaggcttgacttactcct |
267 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23016735 |
atatgataagttgaatttccatacctgggcatgctgatgaaatcattggcaggcttgacttactcct |
23016801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 267
Target Start/End: Complemental strand, 54914853 - 54914791
Alignment:
| Q |
205 |
gataagttgaatttctatacctgggcatgctgatgaaatcattggcaggcttgacttactcct |
267 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||| |||||| || ||||| ||||||||||| |
|
|
| T |
54914853 |
gataggttgaatttccatacctgggcatgctgatgcaatcatgggtaggctagacttactcct |
54914791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University