View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19625_low_8 (Length: 210)
Name: NF19625_low_8
Description: NF19625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19625_low_8 |
 | |
|
| [»] scaffold0041 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0041 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 37052 - 36869
Alignment:
| Q |
18 |
atgatgaatagtaagagttctgccagagatcgaagacttgaaaagttacaagaaattaaatccttaaggaatgagtcaatcaaagattggtttggg---- |
113 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37052 |
atgatgaatagtgagagtcctgccagagatcgaagacttgaaaagttacaagaaattaaatccttaaggaatgagtcaatcaaagattggtttgggttct |
36953 |
T |
|
| Q |
114 |
--ttttggttttacattgcctttccatttatttttgcaaactgttattcctaggataaagaccatttttatgctatcctatgct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36952 |
gattttggttttacattgcctttccatttatttttgcaaactgttattcctaggataaagaccatttttatgctatcctatgct |
36869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University