View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19626_high_8 (Length: 218)
Name: NF19626_high_8
Description: NF19626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19626_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 16 - 104
Target Start/End: Original strand, 32317842 - 32317936
Alignment:
| Q |
16 |
aatactaccctcagagtggaagtacttcacaaacacatggtaagc------ttagtgtaattatctcacataaattgtacacttttcacataatt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32317842 |
aatactaccctcagagtggaagtacttcacaaacacatggtaagctttagtttaatataattatctcacataaattgtacacttttcacataatt |
32317936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 16 - 104
Target Start/End: Complemental strand, 32306400 - 32306304
Alignment:
| Q |
16 |
aatactaccctcagagtggaagtacttcacaaacacatggtaagcttagtgta--------attatctcacataaattgtacacttttcacataatt |
104 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32306400 |
aatactaccctcagagtggcggtacttcacaaacacatggtaagcttagtttaatataattattatatcacataaattgtacacttttcacataatt |
32306304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University