View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19626_low_6 (Length: 241)
Name: NF19626_low_6
Description: NF19626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19626_low_6 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 53 - 241
Target Start/End: Original strand, 1673517 - 1673705
Alignment:
| Q |
53 |
aatagtatcggagtcctagttcgacttgatggaaaagcaggggaagcgggaacttggctttagaagtttatagacgccacatctataatttattatgttg |
152 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1673517 |
aataatatcagagtcctagttcgacttgatggaaaagcaggggaagcgggaacttggctttagaagtttatagacgccacatctataatttattatgttg |
1673616 |
T |
|
| Q |
153 |
gttttgggacaggtgttttatctaaccttgaaagtttaaattagagatgtgagatgtccatgttattcttgtttttgtttttatacgtt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1673617 |
gttttgggacaggtgttttatctaaccttgaaagtttaaattagagatgtgagatgtccatgttattcttgtttttgtttttatacgtt |
1673705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 1673399 - 1673448
Alignment:
| Q |
1 |
tatgtcagtacatcaagaatattagagaggaagatgtcatatcttcacct |
50 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1673399 |
tatgtcaatacatcaagaatattagagaggaagatgtaatatcttcacct |
1673448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University