View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19628_high_33 (Length: 345)
Name: NF19628_high_33
Description: NF19628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19628_high_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 127 - 330
Target Start/End: Complemental strand, 15450028 - 15449825
Alignment:
| Q |
127 |
aaatcaagatggttattacctttaaactctcgtaccttgcctcttttcactctcccacgtacacctctaatattaaaagatccaataatcattatgacat |
226 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15450028 |
aaatcaagatggttattagctttaaactctcgcagcttgcctcttttcactctccgacgtacacctctaatattaaaagatccaataatcattatgacat |
15449929 |
T |
 |
| Q |
227 |
gatatctaaccctctaagactcaaaccctagcattccgctacctcacaagcaacctagtaacttacattgttctcaccatcacacctaaaagaaaatcca |
326 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15449928 |
gatatctaaccccctaagactcaaaccatagcattccgctacctcacaagcaacccagtaacttaccttgttctcaccatcacacctaaaagaaaatcca |
15449829 |
T |
 |
| Q |
327 |
attt |
330 |
Q |
| |
|
|||| |
|
|
| T |
15449828 |
attt |
15449825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University