View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19628_high_37 (Length: 323)
Name: NF19628_high_37
Description: NF19628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19628_high_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 32080892 - 32080583
Alignment:
| Q |
1 |
ttgcctatccttggtatcactatcgggcgtctggttcagaatttcgatcttttgcctccacctggacaatcaaagattgacacttctgagaaaggaggac |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32080892 |
ttgcctatccttggtatcactattgggcgtctggttcagaatttcgagcttttgcctccacctggacaatcaaagattgacacttctgagaaaggaggac |
32080793 |
T |
|
| Q |
101 |
agtttagtctgcatatactcaaacattcaaccattgttgctaagccaagatcattttaattagtcttcacattaatacccttttaatttgttttacttta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32080792 |
agtttagtctgcatatactcaaacattcaaccattgttgctaagccaagatcattttaattagtcttcacactaatacccttttaatttgttttacttta |
32080693 |
T |
|
| Q |
201 |
ctttgtgtaatgcattttaataattcaaaatgtgggaatgttattaaaatgtcttattagcctgcaatttggtaggtgaataatgttgttgttttgtgct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32080692 |
ctttgtgtaatgcattttaataattcaaaatgtgggaatgttattaaaatgtcttattagcctgcaattgggtaggtgaataatgttgttgttttgtgct |
32080593 |
T |
|
| Q |
301 |
tgtcctatgt |
310 |
Q |
| |
|
||||| |||| |
|
|
| T |
32080592 |
tgtcccatgt |
32080583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University