View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19628_high_43 (Length: 284)
Name: NF19628_high_43
Description: NF19628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19628_high_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 21 - 266
Target Start/End: Complemental strand, 5399880 - 5399635
Alignment:
| Q |
21 |
tgtgattgatggtatatatatagcttactatgtatctcttttttcaggaacgtttcatatcacgaagctcatatctaaaacgccacctaacatccctctc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5399880 |
tgtgattgatggtatatatatagcttactatgtatctcttttttcaggaacgtttcatatcacgaagctcatatctaaaacgccacctaacatccctctc |
5399781 |
T |
 |
| Q |
121 |
cgacttcacactctccccaccattaaacataacggcttcaacattcacaaccgttgcagaattttgttacaaccgtaaaatccatttaacaccaacaaac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5399780 |
cgacttcacactctccccaccattaaacataacggcttcatcattcacaaccgttgcagaattttgttacaaccgtaaaatccatttaacaccaacaaac |
5399681 |
T |
 |
| Q |
221 |
attgcagccgttataacggcagcagagttactaggaatgaaagaag |
266 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5399680 |
attgcagccgttataacgacagcagagttactaggaatgaaagaag |
5399635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University