View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19628_high_45 (Length: 274)
Name: NF19628_high_45
Description: NF19628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19628_high_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 24 - 176
Target Start/End: Original strand, 30784648 - 30784801
Alignment:
| Q |
24 |
tcaaataacattct-cggtcactacagtgtttaaatagagtatgatatacttaatgggcttaattaacgcgatgaataaaatcaatacaaataattacaa |
122 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30784648 |
tcaaataacattcttcggtcactacagtgtttaaatagagtatgatatacttaatgggcttaattaacgcgatgaataaaatcaatacaaataattacaa |
30784747 |
T |
 |
| Q |
123 |
aatatcaaattttatttacaacacaccctctcaaaccggtgagtggatattttt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30784748 |
aatatcaaattttatttacaacacaccctctcaaaccggtgagtggatattttt |
30784801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 41 - 150
Target Start/End: Original strand, 30247776 - 30247885
Alignment:
| Q |
41 |
tcactacagtgtttaaatagagtatgatatacttaatgggcttaattaacgcgatgaataaaatcaatacaaataattacaaaatatcaaattttattta |
140 |
Q |
| |
|
|||||| |||||||| ||||||||| ||||||||||||||||||||||||| || | |||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30247776 |
tcactaaagtgtttatatagagtataatatacttaatgggcttaattaacgggacggataatatctatacaaataattacaaaatatcaaattttattta |
30247875 |
T |
 |
| Q |
141 |
caacacaccc |
150 |
Q |
| |
|
|||||||||| |
|
|
| T |
30247876 |
caacacaccc |
30247885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University