View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19628_high_46 (Length: 262)

Name: NF19628_high_46
Description: NF19628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19628_high_46
NF19628_high_46
[»] chr4 (1 HSPs)
chr4 (11-245)||(11024078-11024312)


Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 11 - 245
Target Start/End: Original strand, 11024078 - 11024312
Alignment:
11 gatgaaggaagaaaagaaaggaatgttgattaaaggatgggttccacaagcgttaatattggatcatccatcgataggcggattcttaacgcattgtggc 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11024078 gatgaaggaagaaaagaaaggaatgttgattaaaggatgggttccacaagcgttaatattggatcatccatcgataggcggattcttaacgcattgtggc 11024177  T
111 tggaacgcgaccgtggaagcaataagttccggagtaccaatggttacaatgcccggattcggggatcaatattacaacgagaaattggtgactgaggtgc 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11024178 tggaacgcgaccgtggaagcaataagttccggagtaccaatggttacaatgcccggattcggggatcaatattacaacgagaaattggtgactgaggtgc 11024277  T
211 atcgcattggcgtggaagttggcgccgcagagtgg 245  Q
    |||||||||||||||||||||||||||| ||||||    
11024278 atcgcattggcgtggaagttggcgccgcggagtgg 11024312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University