View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19628_low_33 (Length: 349)
Name: NF19628_low_33
Description: NF19628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19628_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 14 - 331
Target Start/End: Original strand, 6373317 - 6373634
Alignment:
| Q |
14 |
atatctttatggtgacatggatccgacttgtgtggcacatcgtctagagcgccgtccctaagatgatgcattgcattgcatgcacggaacaaaaagtaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6373317 |
atatctttatggtgacatggatccgacttgtgtggcacatcgtctagagcgccgtccctaagatgatgcattgcattgcatgcacggaacaaaaagtaaa |
6373416 |
T |
 |
| Q |
114 |
ctccacgaaacttcaactaaaatgactttaaacatggtagtagtatttttgttctccccagcgatgcaaactcacatgcccctcttaggcttgtgcccct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6373417 |
ctccacgaaacttcaactaaaatgactttaaacatgggagtagtatttttgttctccccaacgatgcaaattcacatgcccctcttaggcttgtgcccct |
6373516 |
T |
 |
| Q |
214 |
tccgcatattttgccaacaatcacacccacatttccagcaacaattctatgaaattatacccttcaataacagacatctctccctctaattaatattgat |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6373517 |
tccgcatattttgccaacaatcacacccacatttccagcaacaattctatgaaattatacccttcaataacagacatctctccctctaattaatattgat |
6373616 |
T |
 |
| Q |
314 |
tgatgtgcacacccttag |
331 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6373617 |
tgatgtgcacacccttag |
6373634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University