View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19628_low_36 (Length: 341)

Name: NF19628_low_36
Description: NF19628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19628_low_36
NF19628_low_36
[»] chr3 (6 HSPs)
chr3 (1-312)||(4530209-4530524)
chr3 (169-294)||(4498958-4499084)
chr3 (169-312)||(4397592-4397732)
chr3 (240-312)||(4520027-4520099)
chr3 (28-83)||(4499433-4499488)
chr3 (28-79)||(4520878-4520929)
[»] chr4 (2 HSPs)
chr4 (178-294)||(18033394-18033511)
chr4 (169-312)||(18047594-18047734)


Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 312
Target Start/End: Complemental strand, 4530524 - 4530209
Alignment:
1 atttaagagagtatat--tcaaaaccacatccatgattgaggaaagatttt-gacacaagtaaaatacttgaataatgatggtctcataggaaggatctc 97  Q
    ||||||||||||||||  |||||| |||||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||    
4530524 atttaagagagtatatattcaaaaacacatccatgattgaggaaagatttttgactcaagtaaaatacttgagtaatgatggtctcataggaaggatctc 4530425  T
98 aacttttcggatgcaagagactttacgccagttttttccatatggttttgcatatctttcctctaataatgagcagttataaatgcaaagtttctgcaaa 197  Q
    |||||||||||||| ||||| ||||||||||| ||  |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
4530424 aacttttcggatgcgagagattttacgccagtcttgaccatatggttttgcatatctttcctctaataatgagcagttatacatgcaaagtttctgcaaa 4530325  T
198 gatacaaggttatgtattgcttcgggcagtgatgt-aaaccattgcaattgtggaactcaagggtcaagagcgatgagagattccctatccagtctggca 296  Q
    |||||||||||| | || ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |    
4530324 gatacaaggttacgcatcgcttcgggcagtgatgtcaaaccattgcaattgtggaactcaagagtcaagagcgatgagagattccctatccagtctggta 4530225  T
297 atcttttgccgcaaaa 312  Q
    |  |||||||||||||    
4530224 actttttgccgcaaaa 4530209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 169 - 294
Target Start/End: Complemental strand, 4499084 - 4498958
Alignment:
169 agcagttataaatgcaaagtttctgcaaagatacaaggttatgtattgcttcgggcagtgatgt-aaaccattgcaattgtggaactcaagggtcaagag 267  Q
    |||||||| ||||||||||||||||||||||||||||||||   ||| |||||||||||||||| |||| ||||||||||||||||||||| ||||||||    
4499084 agcagttagaaatgcaaagtttctgcaaagatacaaggttactcatttcttcgggcagtgatgtcaaactattgcaattgtggaactcaagagtcaagag 4498985  T
268 cgatgagagattccctatccagtctgg 294  Q
    ||||||||||||||  |||||||||||    
4498984 cgatgagagattccacatccagtctgg 4498958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 169 - 312
Target Start/End: Original strand, 4397592 - 4397732
Alignment:
169 agcagttataaatgcaaagtttctgcaaagatacaaggttatgtattgcttcgggcagtgatgt-aaaccattgcaattgtggaactcaagggtcaagag 267  Q
    |||||||| |||||||||| | || ||||||||||||||||   |   |||| |||||| |||| |||| |||||||||||||| |||||| ||||||||    
4397592 agcagttagaaatgcaaaggt-cttcaaagatacaaggttacaca---cttccggcagtaatgtcaaactattgcaattgtggatctcaagagtcaagag 4397687  T
268 cgatgagagattccctatccagtctggcaatcttttgccgcaaaa 312  Q
    |||||||||||||| |||||||||||| || ||  ||||||||||    
4397688 cgatgagagattccatatccagtctggtaacctgctgccgcaaaa 4397732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 4520099 - 4520027
Alignment:
240 tgcaattgtggaactcaagggtcaagagcgatgagagattccctatccagtctggcaatcttttgccgcaaaa 312  Q
    ||||||||||||||||||| |||||||||||||||||||| | |||||||||||| ||  |||||||||||||    
4520099 tgcaattgtggaactcaagagtcaagagcgatgagagattacatatccagtctggtaactttttgccgcaaaa 4520027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 4499488 - 4499433
Alignment:
28 tccatgattgaggaaagattttgacacaagtaaaatacttgaataatgatggtctc 83  Q
    ||||||||||||||||||||||||| |||||||||||||||| |||||||||||||    
4499488 tccatgattgaggaaagattttgactcaagtaaaatacttgagtaatgatggtctc 4499433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 28 - 79
Target Start/End: Complemental strand, 4520929 - 4520878
Alignment:
28 tccatgattgaggaaagattttgacacaagtaaaatacttgaataatgatgg 79  Q
    ||||||||||| ||||||||||||| |||| ||||||||||| |||||||||    
4520929 tccatgattgatgaaagattttgactcaagaaaaatacttgagtaatgatgg 4520878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 78; Significance: 3e-36; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 178 - 294
Target Start/End: Original strand, 18033394 - 18033511
Alignment:
178 aaatgcaaagtttctgcaaagatacaaggttatgtattgcttcgggcagtgatgt-aaaccattgcaattgtggaactcaagggtcaagagcgatgagag 276  Q
    ||||||||||||||||||||||||||||||||   ||| |||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||    
18033394 aaatgcaaagtttctgcaaagatacaaggttactcatttcttcgggcagtgatgtcaaactattgcaattgtggaactcaagagtcaagagcgatgagag 18033493  T
277 attccctatccagtctgg 294  Q
    |||||  |||||||||||    
18033494 attccacatccagtctgg 18033511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 169 - 312
Target Start/End: Complemental strand, 18047734 - 18047594
Alignment:
169 agcagttataaatgcaaagtttctgcaaagatacaaggttatgtattgcttcgggcagtgatgt-aaaccattgcaattgtggaactcaagggtcaagag 267  Q
    |||||||| |||||||||| | || ||||||||||||||||   |   |||| |||||| |||| |||| |||||||||||||| |||||| ||||||||    
18047734 agcagttagaaatgcaaaggt-cttcaaagatacaaggttacaca---cttccggcagtaatgtcaaactattgcaattgtggatctcaagagtcaagag 18047639  T
268 cgatgagagattccctatccagtctggcaatcttttgccgcaaaa 312  Q
    |||||||||||||| |||||||||||| || ||  ||||||||||    
18047638 cgatgagagattccatatccagtctggtaacctgctgccgcaaaa 18047594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University