View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19628_low_57 (Length: 224)
Name: NF19628_low_57
Description: NF19628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19628_low_57 |
 | |
|
| [»] scaffold0092 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0092 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 22402 - 22616
Alignment:
| Q |
1 |
aaaattcaaagtcatgtacaagaggaagctatatcctcatggaaagtttgggaacctcctgatccaacaaggaggtccatgaaaaccaggtgataaatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
22402 |
aaaattcaaagtcatgtacaagaggaagctatatcctcatggaaagtttgggaacctcctgatcgaacaaggaggtccatgaaaaccaggtgaaaaatag |
22501 |
T |
|
| Q |
101 |
aggatgtttatttaccnnnnnnnnnnaggatttcttgctatgaaactatgtgattggtctaggtcaaactatttacattttatatagggattttatttac |
200 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22502 |
aggatgttt-tttactttttttttttaggatttcttgctatgaaactatgtgattggtctaggtccaactatttacattttatatagggattttatttac |
22600 |
T |
|
| Q |
201 |
catcactatgatgatg |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
22601 |
catcactatgatgatg |
22616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University