View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1962_1D_low_26 (Length: 304)
Name: NF1962_1D_low_26
Description: NF1962_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1962_1D_low_26 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 21 - 304
Target Start/End: Original strand, 41735698 - 41735981
Alignment:
| Q |
21 |
gtaagccaggtcatcatgcacctcagtgcaaacatcgcaagaggaaagacaatcctcttaaagctaacttgactgaatgaggtgacactattgatgtggt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735698 |
gtaagccaggtcatcatgcacctcagtgcaaacatcgcaagaggaaagacaatcctcttaaagctaacttgactgaatgaggtgacactattgatgtggt |
41735797 |
T |
 |
| Q |
121 |
taattataaattgtttggaatgggagctgggaggtgcatgatgatatggattaccacaaacataactaattttcttttgcaggtgagattaataacatga |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735798 |
taattataaattgtttggaatgggagctgggaggtgcatgatgatatggattaccacaaacataactaattttcttttgcaggtgagattaataacatga |
41735897 |
T |
 |
| Q |
221 |
ggaacataattgttattactattgtgattaggcttgtgatcatgactctttttgtgagaattattatgagtcttcagattttct |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735898 |
ggaacataattgttattactattgtgattaggcttgtgatcataactctttttgtgagaattattatgagtcttcagattttct |
41735981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University