View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1962_1D_low_28 (Length: 291)
Name: NF1962_1D_low_28
Description: NF1962_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1962_1D_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 25 - 269
Target Start/End: Complemental strand, 40288172 - 40287924
Alignment:
| Q |
25 |
gttgaaacagttgtctctaaaattgcagttttccataattgctttcatttatgaattgattacaaatcaaggtcatcaatccaaaattgaggaaaacttc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40288172 |
gttgaaacagttgtctctaaaattgcagttttccataattgctttcatttatgaattgattacaaatcaaggtcatcaatccaaacttgaggaaaacttc |
40288073 |
T |
|
| Q |
125 |
atctgttcggaaaatggaaacggaaatgggccacggaaagt----ggtcctcaagctttgacaagagttcttaccattacctccgatgtattgttaacac |
220 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40288072 |
atctgttcggaaaattgaaacggaaatgggccacggaaagtggtcggtcctcaagctttgacaagagttcttaccattacctccgatgtattgttaacac |
40287973 |
T |
|
| Q |
221 |
gagatatatttgtgaataatgtttctttggcaggagcttaacaagattg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40287972 |
gagatatatttgtgaataatgtttctttggcaggagcttaacaagattg |
40287924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University