View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1962_1D_low_29 (Length: 291)
Name: NF1962_1D_low_29
Description: NF1962_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1962_1D_low_29 |
 | |
|
| [»] scaffold0300 (4 HSPs) |
| | |
|
Alignment Details
Target: scaffold0300 (Bit Score: 101; Significance: 4e-50; HSPs: 4)
Name: scaffold0300
Description:
Target: scaffold0300; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 165 - 285
Target Start/End: Complemental strand, 2342 - 2222
Alignment:
| Q |
165 |
aatagggattcttcttttctcattgtaaatgtctttatgggatcttccatattattgtgtaggaaaatcagacccatgataagccaacactatcatattt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
2342 |
aatagggattcttcttttctcattgtaaaggtctttatgggatcttcaatattattgtggaggaaaatcaaacccatgataagccaacactagcatattt |
2243 |
T |
|
| Q |
265 |
gatagagtcgtttttgagaat |
285 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2242 |
gatagagtcgtttttgagaat |
2222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0300; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 164 - 285
Target Start/End: Original strand, 949 - 1070
Alignment:
| Q |
164 |
caatagggattcttcttttctcattgtaaatgtctttatgggatcttccatattattgtgtaggaaaatcagacccatgataagccaacactatcatatt |
263 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
949 |
caatagggattcttcttttctcatagtaaaggtctttatgggatcttcgatattattgtggaggaaaatcaaacccatgataagccaacactagcatatt |
1048 |
T |
|
| Q |
264 |
tgatagagtcgtttttgagaat |
285 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
1049 |
cgatagagttgtttttgagaat |
1070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0300; HSP #3
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 2476 - 2391
Alignment:
| Q |
1 |
tggcatatctgtatcaaggtatgaaggattggaagaaaaagggtaagtcattagacgacttcacccgacttttaatggtaagagca |
86 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||| | ||| |||||||||||||| |
|
|
| T |
2476 |
tggcatatctgtatcaaggtatgaaagattgaaagaaaaagggtaagtcattagacggcttcacctggcttataatggtaagagca |
2391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0300; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 5 - 45
Target Start/End: Original strand, 488 - 528
Alignment:
| Q |
5 |
atatctgtatcaaggtatgaaggattggaagaaaaagggta |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
488 |
atatctgtatcaaggtatgaaggattggaagaaaaaaggta |
528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University