View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1962_1D_low_52 (Length: 240)
Name: NF1962_1D_low_52
Description: NF1962_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1962_1D_low_52 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 12 - 215
Target Start/End: Complemental strand, 12171428 - 12171223
Alignment:
| Q |
12 |
atggacatcataggaaagaatcaccagtgaaaacaagaactcacatttattggagtgccagag--gtaagaaatgctaatttccccaagaaaatgttcct |
109 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
12171428 |
atggacatcataggaaataatcaccagtgaaaataagaactcacatttattggagtgccagagaggtaagaaatgctaatttccccaagaaaaagttcct |
12171329 |
T |
|
| Q |
110 |
tgtcctcggtaactacagttccagcacaagcagttgacagaacttcaaccaaggaaccaaccgcgcctccatgcagtgttccataggcattctgcatttc |
209 |
Q |
| |
|
||||||| | ||||||||||| ||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12171328 |
tgtcctcagcaactacagttctagcacaagcagttgacagaacttcaactaaggacccaacagcgcctccatgcagtgttccataggcattctgcaattc |
12171229 |
T |
|
| Q |
210 |
cgacaa |
215 |
Q |
| |
|
|||||| |
|
|
| T |
12171228 |
cgacaa |
12171223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 12 - 215
Target Start/End: Complemental strand, 12415856 - 12415651
Alignment:
| Q |
12 |
atggacatcataggaaagaatcaccagtgaaaacaagaactcacatttattggagtgccagag--gtaagaaatgctaatttccccaagaaaatgttcct |
109 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
12415856 |
atggacatcataggaaataatcaccagtgaaaataagaactcacatttattggagtgccagagaggtaagaaatgctaatttccccaagaaaaagttcct |
12415757 |
T |
|
| Q |
110 |
tgtcctcggtaactacagttccagcacaagcagttgacagaacttcaaccaaggaaccaaccgcgcctccatgcagtgttccataggcattctgcatttc |
209 |
Q |
| |
|
||||||| | ||||||||||| ||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12415756 |
tgtcctcagcaactacagttctagcacaagcagttgacagaacttcaactaaggacccaacagcgcctccatgcagtgttccataggcattctgcaattc |
12415657 |
T |
|
| Q |
210 |
cgacaa |
215 |
Q |
| |
|
|||||| |
|
|
| T |
12415656 |
cgacaa |
12415651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University