View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1962_1D_low_59 (Length: 224)
Name: NF1962_1D_low_59
Description: NF1962_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1962_1D_low_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 68 - 217
Target Start/End: Complemental strand, 47294724 - 47294581
Alignment:
| Q |
68 |
ctatttgagaatttcgatttggtataatggctattatgctcaattaataacataatgtcttcnnnnnnnnnnatagaatattataagttagtaattacta |
167 |
Q |
| |
|
||||||| ||||||| |||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
47294724 |
ctatttgggaatttcaatttggtatattggctattatgctcaattaataacaaaatgtctt------tttttatagaatattataagctagtaattacta |
47294631 |
T |
|
| Q |
168 |
gtcgatcacaaacttgattggctttaccttttatcgatttaataactcca |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47294630 |
gtcaatcacaaacttgattggctttaccttttatcgatttaataactcca |
47294581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 209
Target Start/End: Complemental strand, 56044766 - 56044713
Alignment:
| Q |
156 |
tagtaattactagtcgatcacaaacttgattggctttaccttttatcgatttaa |
209 |
Q |
| |
|
|||||||||||| || ||||||||||| |||||| ||| ||||||| ||||||| |
|
|
| T |
56044766 |
tagtaattactaatcaatcacaaacttcattggcgttatcttttattgatttaa |
56044713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University