View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1962_1D_low_64 (Length: 208)
Name: NF1962_1D_low_64
Description: NF1962_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1962_1D_low_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 14 - 186
Target Start/End: Complemental strand, 13281022 - 13280850
Alignment:
| Q |
14 |
acatcaccatgtatgtctaagggtgttgtgaaaaacacttcattgctcaagttgaatgacacaacatcagttttatcatttatccttcgcaaccagtgac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13281022 |
acatcaccatgtatgtctaagggtgttgtgaaaaacacttcattgctcaagttgaatgacacaacatcagttttatcatttatccttcgcaaccagtgac |
13280923 |
T |
 |
| Q |
114 |
acactccatccaagtacacctcagaactcaacgggccgtagaaaacaattagtatatcaacatcgagttttct |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13280922 |
acactccatccaagtacacctcagaactcaacgggccgtagaaaacaattggtatatcaacatcgagttttct |
13280850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 79
Target Start/End: Original strand, 27230444 - 27230488
Alignment:
| Q |
35 |
ggtgttgtgaaaaacacttcattgctcaagttgaatgacacaaca |
79 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
27230444 |
ggtgtagtgaaaaacacatcattggtcaagttaaatgacacaaca |
27230488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University