View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1962_2D_low_1 (Length: 253)
Name: NF1962_2D_low_1
Description: NF1962_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1962_2D_low_1 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 116 - 253
Target Start/End: Complemental strand, 14211701 - 14211564
Alignment:
| Q |
116 |
gcatcattgatgatcattgaagaacttgtaacttcatttgactatgctacaaataacatgcatttggaagtaatcagttcccctcatgttctcagtggac |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14211701 |
gcatcgttgatgatcattgaagaacttgtaacttcaattgactatgctacaaataacatgcatttggaagtaatcagttcccctcatgttctcagtggac |
14211602 |
T |
|
| Q |
216 |
ttatagaagttgcaagaaatcataatcttgatgagttt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14211601 |
ttatagaagttgcaagaaatcataatcttgatgagttt |
14211564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 119
Target Start/End: Original strand, 14211436 - 14211537
Alignment:
| Q |
18 |
catttggcatgaacattttccgtctctagaaggtgtagaaatggagcaagaggagtgaactgtgacacatactttctacaccgtgaatcaaactgcatgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14211436 |
catttggcatgaacattttccgtctctagaaggtgtagaaatggagcaagaggagtgaactgtgacacatactttctacactgtgaatcaaactgcatgc |
14211535 |
T |
|
| Q |
118 |
at |
119 |
Q |
| |
|
|| |
|
|
| T |
14211536 |
at |
14211537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University