View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1962_2D_low_3 (Length: 215)
Name: NF1962_2D_low_3
Description: NF1962_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1962_2D_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 7874079 - 7873878
Alignment:
| Q |
1 |
cttatcctcaaaagcttgattacaaaacagtgttcatatttcagtgacttgtttggaaagctatgcaagttaatttctgtatgtttttnnnnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7874079 |
cttatcctcaaaagcttgattacaaaacagtgttcatatttcattgacttgttcggaaagctatgcaagttaatttctgtatgtttttaaaaagaaaaaa |
7873980 |
T |
 |
| Q |
101 |
ntacacaccaggtagagcttgctgcattcggagcaatgttgcaaaagtaatttagctttctcaattgagttgttcagaaaacatagagactctattcctg |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7873979 |
-tacacaccaggtagagtttgctgcattcggagcaatgttgcaaaagtaatttagctttctcaattgagttgttcagaaaacatagagactctattcctg |
7873881 |
T |
 |
| Q |
201 |
atg |
203 |
Q |
| |
|
||| |
|
|
| T |
7873880 |
atg |
7873878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University